If you have been reading about research chemical and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Last reviewed on 2025-09-03. Where a claim depends on a specific study, the study is described rather than over-claimed.
Literature on cardarine often separates receptor pharmacology from toxicology. Mechanistic papers describe PPARδ activation and gene expression changes, while safety assessments focus on carcinogenicity and species differences. Questions remain about whether rodent tumors arise through PPARδ-dependent or off-target mechanisms. Another open area is how human metabolism and exposure compare with those in animal studies. Analytical methods such as liquid chromatography–mass spectrometry are used to confirm identity in biological and product samples.
GW501516 acts as an agonist at the peroxisome proliferator-activated receptor delta, a nuclear receptor that regulates gene expression. Activation shifts transcription toward genes involved in fatty acid uptake, oxidation, and energy expenditure. The compound does not bind the androgen receptor and therefore differs from anabolic steroids and SARMs. In rodent models, this metabolic shift has been linked to increased running endurance and reduced fat accumulation. The exact downstream pathways in humans remain incompletely characterized.
At the molecular level, GW501516 binds and activates PPARδ, a nuclear receptor that regulates transcription. Activation shifts expression of genes involved in fatty acid oxidation, energy expenditure, and lipid transport in skeletal muscle and liver. Animal studies report increased endurance and altered lipid profiles after exposure. Human data are limited to small trials and do not establish long-term safety or efficacy. PPARδ also has roles in cell proliferation, so the relationship between activation and cancer risk remains an open question.
Published literature on cardarine includes in vitro assays, rodent experiments, and a small number of human studies. Reports describe effects on exercise capacity and lipid metabolism in animals, while human evidence is sparse. Many online descriptions present the compound as a proven endurance aid, a claim not supported by regulatory approval or large clinical trials. Analytical studies focus on identifying the parent compound and its metabolites in biological samples. Important uncertainties include species differences, dose-response relationships, and the relevance of rodent tumor findings to humans.
| Property | Value | Notes |
|---|---|---|
| Primary target | PPARδ | Nuclear receptor; not androgen receptor |
| Studied indications | Dyslipidemia; obesity; diabetes | Early clinical research; development discontinued |
| Rodent toxicity | Tumor formation in multiple tissues | Dose-dependent findings in some studies |
| Human approval | None | No approved therapeutic use |
| Typical analytical method | LC-MS/MS | Used for identity and quantification |
Cardarine is a common name for GW501516, a synthetic compound studied for its effects on lipid and glucose metabolism. It functions as an agonist at peroxisome proliferator-activated receptor delta, or PPARδ, a nuclear receptor that influences gene expression. The molecule is not a steroid, nor is it a selective androgen receptor modulator. It is also known in research and sports literature as GW-501516 and endurobol. Early laboratory work examined its metabolic activity in cell cultures and animal models.
Activation of PPARδ changes transcription of genes involved in fatty acid transport, mitochondrial function, and skeletal muscle fuel preference. In rodent studies, pharmacological PPARδ activation was associated with increased endurance and altered body composition. These findings generated interest in performance enhancement, but species differences and study designs limit direct extrapolation to humans. Small human trials were conducted in the 2000s and later discontinued. The extent to which cardarine produces similar metabolic or performance effects in people remains an open question.
Cardarine is explicitly prohibited by the World Anti-Doping Agency under the class of PPARδ agonists. Its presence in urine or blood samples can be detected using mass spectrometry-based methods, often liquid chromatography-tandem mass spectrometry. Athletes who test positive may face sanctions, including bans from competition. The compound is also regulated as a prescription-only or unapproved drug in many countries. Enforcement varies by jurisdiction, and some regions treat it as a controlled substance. Online sales may occur despite these restrictions, creating quality and legal risks.
Laboratory detection of cardarine typically involves sample preparation followed by chromatographic separation and mass spectrometric identification. Urine is the most common matrix for anti-doping tests, though blood and hair have also been explored. Methods can target the parent compound or its metabolites, depending on the expected window of detection. Reference standards are required for accurate quantification. Matrix effects and dilution can influence results, so laboratories use internal standards and validation protocols. The exact detection window varies with dose, route, and individual metabolism.
A common misconception is that cardarine has been proven safe for human use. In reality, human clinical data are limited, and long-term animal studies have raised concerns about cancer. Another misconception is that it is a supplement or vitamin-like compound. It is a synthetic research chemical with no approved medical indication. Scientific discussion often focuses on its mechanism and detection rather than therapeutic use. Regulatory and anti-doping literature treats it primarily as a prohibited substance.
GW501516 acts as an agonist at peroxisome proliferator-activated receptor delta, a nuclear receptor involved in transcription of genes related to lipid handling and energy use. Activation of PPARδ can shift skeletal muscle toward greater fatty acid oxidation in animal models, which is one reason it drew interest for metabolic disease and exercise research. The exact downstream effects depend on tissue, species, dose, and duration. Human data are sparse, so many proposed benefits remain hypotheses rather than established clinical outcomes.
Laboratory studies have examined GW501516 in cell cultures and rodents for conditions such as dyslipidemia, insulin resistance, and obesity. Some trials in humans were initiated, but development was discontinued after preclinical findings raised concerns about cancer in certain models. Those findings do not prove that the compound causes cancer in people, but they contributed to regulatory caution. Later reviews often describe the evidence as preliminary and insufficient for assessing long-term safety.
=== Synthetic polymers === ECD studies of polyalkene glycols, polyamides, polyacrylates and polyesters are useful for understanding composition of polymer samples. It has become a powerful technique to analyze structural information about precursor ions during MS/MS for synthetic polymers. ECD's single bond cleavage tendency makes the interpretation of product ion scans simple and easy for polymer chemistry.
In food packaging, sealing plays an important role in ensuring food safety, product preservation, and package integrity. Sealing is used to hermetically close bags made of plastic or multilayer materials, such as pouches, trays, or flexible films. More employed techniques in food industry include heat sealing, which requires the use of hot air, ultrasound, or induction to generate heat, laser sealing, and cold sealing. These processes guarantee a barrier against external agents, such as oxygen, moisture, light, and microorganisms, preventing contamination and extending the product's shelf life. The quality of the seal is a critical parameter: a defective seal can lead to the degradation of organoleptic properties and also compromise food safety. For this reason, the food industry adopts international quality control standards to assess the integrity of the sealing.
The owners of the land where Lindow Man was found donated the body to the British Museum, and on 21 August it was transported to London. At the time, the body was dubbed "Pete Marsh" by Middlesex Hospital radiologists, a name subsequently adopted by local journalists, as was the similar "Pete Bogg". Lindow Man's official name is Lindow II, as there are other finds from the area: Lindow I (Lindow Woman) refers to a human skull, Lindow III to a "fragmented headless body", and Lindow IV to the upper thigh of an adult male, possibly that of Lindow Man. After the discovery of Lindow Man, there were no further archaeological excavations at Lindow Moss until 1987. A large piece of skin was found by workmen on the elevator on 6 February 1987. On this occasion, the police left the investigation to the archaeologists. Over 70 pieces were found, constituting Lindow III. Although the bone was not as well preserved as that of Lindow Man, the other tissues survived in better condition. The final discovery was that of Lindow IV on 14 June 1988. Part of a left leg and buttocks were found on the elevator, from a site just 15 metres (50 ft) west of where Lindow Man was found. Nearly three months later, on 12 September, a right thigh was discovered in the peat on the bucket of a digger. The proximity of the discovery sites, coupled with the fact that the remains were shown to come from an adult male, means that Lindow IV is probably part of Lindow Man.
Other researchers also began using UV-photolysis in prebiotic schemes, as the UV flux would have been much higher on early Earth. For example, UV-photolysis of water vapor with carbon monoxide was found to yield various alcohols, aldehydes, and organic acids. In the 1970s, Carl Sagan used Miller–Urey-type reactions to synthesize and experiment with complex organic particles dubbed "tholins", which likely resemble particles formed in hazy atmospheres like that of Titan.
Sources: en.wikipedia.org
While there are many rehabilitation centres for wealthy people struggling with addiction in South Africa there are very few facilities for the poor. Some have argued that people struggling with heroin addiction are treated as the 'undeserving poor' and subject to policing rather than medical interventions. In the populous province of KwaZulu-Natal there are only two government rehab centres accessible by poor people.
==== Other ==== Many other Wildcats have met with success at the university. Alix Creek and Michelle Oldham won the NCAA Women's Doubles Tennis title in 1993, defeating Texas in the Final. Although surprising to some, the University of Arizona has a noteworthy history in ice hockey. The school's club hockey team, formerly known as the Icecats, won over 800 games between its inception in 1979 and 2011. The Ice Cats defeated Penn State for the National Collegiate Club Hockey National Championship in 1985. They also appeared in eight Final Fours ('84, '86, '87, '88, '91, '93, '94, '97) and ten Elite Eights. As of 2011, they are part of ACHA Division I, and are known formally as the Arizona Wildcats hockey team. Robert M. Tanita was a nationally ranked collegiate wrestler who reached the NCAA finals tournament as WAC champion in 1963. Three national championships for synchronized swimming were won in 1980, 1981, and 1984, though these championships were in the Association of Intercollegiate Athletics for Women, and not the NCAA. Along with winning three national championships in the pool for synchronized swimming, the Wildcats have also won their first NCAA Championship in men and women's swimming and diving for the seasons of 2007–2008. Topping off these weekends Frank Busch, the men and women's head coach, was named NCAA Swimming Coach of the Year. Arizona men became the first team to claim a first-time title since UCLA's win in 1982. Also, the men ended Texas and Auburn's winning streak since 1998.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
It targets PPARδ, a nuclear receptor involved in lipid and energy metabolism. It does not act primarily on androgen receptors. This distinction separates it from SARMs.
Rodent studies found dose-dependent tumors in several organs. The sponsor discontinued the program over cancer concerns. Human risk from long-term use remains unknown.
Controlled human endurance trials are lacking. Animal studies show increased exercise capacity under some conditions. Anecdotal reports are not equivalent to clinical evidence.
Cardarine is a common name for the investigational compound GW501516. It acts as a PPARδ agonist and is not approved for human use. It is prohibited in sport.